Trang chủ Bằng phát minh, sáng chế • Liên hệ     • Giới thiệu     • Tài liệu hướng dẫn

Quy trình sản xuất adenovirut tái tổ hợp mang gen interleukin-6 của gà (chil-6)

Cập nhật Thứ sáu - 09/06/2017 14:03 In bài viết

1. Tên sáng chế, phát minh, giải pháp:
Quy trình sản xuất adenovirut tái tổ hợp mang gen interleukin-6 của gà (chil-6)
2. Số bằng,ký hiệu: 2-0001467
3. Thuộc lĩnh vực KH&CN Công nghệ sinh học (Sáng chế)
4. Ngày công bố 25/01/2017
5. Ngày cấp 25/01/2017
6. Chủ sở hữu chính Viện công nghệ sinh học
7. Tác giả Phạm Việt Cường (VN), Nguyễn Thị Kim Cúc (VN), Lê Thị Hồng Minh (VN), Vũ Thị Thu Huyền (VN), Trần Thị Kim Dung (VN)
8. Điểm nổi bật
Giải pháp hữu ích đề cập đến quy trình sản xuất adenovirut tái tổ hợp để kích thích miễn dịch cho gà trên cơ sở trình tự gen chIL-6 và khung adenovirut giảm độc lực của hãng Invitrogen để tạo ra adenovirut tái tổ hợp mang gen chIL- 6 của gà. Quy trình theo giải pháp hữu ích bao gồm các bước: a) Tạo vectơ pCR2.1 tái tổ hợp; b) Tạo dòng tế bào E.coli tái tổ hợp mang gen chIL-6 của gà; c) Tạo vectơ pUC57/kpn tái tổ hợp; d) Tạo dòng tế bào E.coli tái tổ hợp mang plasmit pUC57/chIL-6; e) Tạo vectơ con thoi tái tổ hợp pETR3C/chIL-6; f) Tạo dòng tế bào E.coli DH5α mang vectơ con thoi tái tổ hợp pETR3C/chIL-6; g) Tạo plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp; h) Tạo dòng tế bào E.coli mang plasmit pAd/CMV/V5-DEST/chIL-6; và i) Thu adenovirut tái tổ hợp mang gen chIL-6 của gà.
9. Mô tả về sáng chế, phát minh, giải pháp

Lĩnh vực kỹ thuật được đề cập

Giải pháp hữu ích thuộc lĩnh vực công nghệ sinh học, cụ thể là đề cập đến công nghệ gen và ứng dụng trong sản xuất vacxin miễn dịch cho động vật. Cụ thể là giải pháp hữu ích đề cập đến quy trình sản xuất adenovirut tái tổ hợp mang gen interleukin-6 của gà (chIL-6) thu được từ gà Lương Phượng-Saccso có tác dụng kích ứng miễn dịch trên cơ sở tái tổ họp gen chIL-6 với khung adenovirut.

Tình trạng kỹ thuật của giải pháp hữu ích

Cytokin nếu được sản xuất bằng con đường tái tổ hợp, rồi tinh sạch sản phẩm và đưa vào cơ thể để tăng cường miễn dịch cho vật chủ thì sẽ rất tốn kém và đòi hỏi phương thức sử dụng bằng đường tiêm, do đó rất phức tạp và không phù hợp nếu áp dụng để tăng cường đáp ứng miễn dịch cho các đối tượng trong các trang trại chăn nuôi gia cầm với số lượng lớn.

Hiện có xu hướng nghiên cứu chọn lọc các cytokin thích hợp, phân lập gen và tái tổ hợp vào vectơ rồi đưa vectơ đó vào cơ thể, ví dụ thông qua ăn, uống, hô hấp, tiêu hóa, niêm mạc thì lợi thế của công nghệ nhân lên hàng chục lần, đặc biệt cho gia cầm nuôi mật độ đông (Johnson và cộng sự, 2000; Rauw và cộng sự, 2007).

Trong các hệ thống vectơ dẫn truyền gen kích ứng miễn dịch và gen kháng nguyên làm vacxin thế hệ mới, hệ thống vectơ adenovirut được đặc biệt chú ý nghiên cứu và sử dụng, do adenovirut có đặc tính thích ứng tế bào đa vật chủ, vô hại với nhiều loài, có khả năng nhân mạnh khi nuôi cấy trên tế bào tổ chức để sản xuất virut in vitro với số lượng virut nhiều, và khi áp dụng in vivo có khả năng nhân ổn định và duy trì nguồn cytokin và kháng nguyên lâu dài, nhưng không gây hại cho vật chủ (Bangari và Mittal, 2006). Hệ thống dẫn truyền adenovirut đã được làm vectơ mang gen kích thích miễn dịch (cyíokine), mang gen liệu pháp để điều trị một số bệnh hiểm nghèo, mang gen kháng nguyên và mang chuỗi oligonucleotit sử dụng trong liệu pháp can thiệp gen (RNAi) để điều trị bệnh (Franceschi và Ge, 2008). Hệ thống dẫn truyền adenovirut cũng được định hướng sử dụng liệu pháp gen để ngăn ngừa và điều trị bệnh ung thư (Hartman và cộng sự, 2008), điều trị ung thư từ tế bào gốc, điều trị bệnh ty thể, định hướng kích ứng miễn dịch (Alesci và cộng sự, 2007; Rittner và cộng sự, 2007), sản xuất kháng thể đơn chuỗi scFv (single chain fragment variable) và biểu hiện kháng thể đơn chuỗi trong tế bào cơ thể (Vellinga và cộng sự, 2007) cũng như định hướng phá bỏ gen thông qua cơ chế can thiệp của RNAi (Grimm và Kay, 2006).

Đã có một số công bố liên quan đến việc sử dụng IL-6 từ gà để tạo ra plasmit tái tổ hợp nhằm kích thích miễn dịch với protein đáp ứng cho vật nuôi, ví dụ: Min Li, The polyclonal antibody against chicken interleukin-6 prepared by immunization of recomninal eukaryotic plasmit can react efficiently with its prokaryotic expression protein, Journal of Animal and Veterianry Advances 9(21), 2679-2684, 2010, đã mô tả việc tạo ra plasmit tái tổ hợp mang gen IL-6 của gà để kích thích đáp ứng miễn dịch, Michael HLKogut, Cytokines and prevention of infections diseases in poultry: a review, Avian Pathology (2000), 19, 395-404 đã mô tả các phương pháp tạo ra adenovimt để kích thích đáp ứng miễn dịch cho gia cầm. Tuy nhiên, các phương pháp nêu trên khó thực hiện và cần các trang thiết bị chuyên dụng và không đặc hiệu đối với phần lớn gà nuôi phổ biến ở Việt Nam.

Đã biết IL-6 là một loại cytokin có vai trò đặc biệt đối với quá trình đáp ứng miễn dịch. IL-6 là cytokin tác động trực tiếp lên lympho B để sản xuất kháng thể (Schneider và cộng sự, 2001). Như vậy, nếu lượng IL-6 được tăng cường từ bên ngoài vào, đặc biệt thông qua vectơ tái tổ hợp để nguồn cytokin được nhân lên và sử dụng tại chỗ trong cơ thể thì sẽ làm tăng về số lượng tế bào đáp ứng miễn dịch (kể cả lympho B sản xuất kháng thể) do IL-6 kích thích, và điều đó sẽ dẫn đến làm tăng số lượng và chất lượng kháng thể (sau nhiễm bệnh hoặc sau khi chủng ngừa) (Asif và cộng sự, 2004; Kishimoto, 2005; Giansanti và cộng sự, 2006; Tayal và Kalra, 2008).

Vì vậy, hiện có nhu cầu rất lớn cho các chế phẩm adenovirut tái tổ hợp có tác dụng kích ứng miễn dịch để sử dụng cho gia cầm, cụ thể là cho gà, đặc biệt trong tình hình cúm gia cầm hiện nay gây thiệt hại rất lớn cho các ngành chăn nuôi. Tuy nhiên, hiện vẫn chưa có quy trình tạo ra adenovirut tái tổ hợp một cách đơn giản, dễ thực hiện, có thể chuyển IL-6 của gia cầm đang được nuôi phổ biến tại Việt Nam để tăng cường được khả năng đáp ứng miễn dịch đặc hiệu cho đàn gia cầm, tăng sức đề kháng, giảm thiệt hại cho ngành chăn nuôi. Do đó, vẫn cần quy trình tạo ra chế phẩm adenovirut nhằm đáp ứng nhu cầu nêu trên

Bản chất kỹ thuật của giải pháp hữu ích

Để giải quyết vấn đề nêu trên, giải pháp hữu ích đề cập đến quy trình sản xuất adenovirut tái tổ hợp để kích thích miễn dịch cho gà, quy trình này bao gồm các bước:

a) Tạo vectơ pCR2.1 tái tổ hợp bằng cách gắn trình tự gen chIL-6 của gà có trình tự nêu trong SEQ ID NO. 1 vào vectơ pCR2.1 bằng enzym T4-ligaza để thu được vectơ pCR2.1 tái tổ hợp;

b) Tạo dòng tê bào E.coli tái tô hợp mang gen chIL-6 của gà băng cách biến nạp vectơ pCR2. 1 tái tổ hợp vào tế bào E.coli Top10F, sau khi chọn lọc và nhân trên môi trường BL có bổ sung 1% ampixilin thu được chủng E.coli Top10F tái tổ họp mang gen chIL-6 của gà;

c) Tạo vectơ pUC57/kpn tái tổ hợp bằng cách thu đoạn gen chIL-6 từ chủng E.coli Top10F tái tổ hợp thu được từ bước b) và tiến hành PCR với cặp mồi có trình tự nêu trong SEQ ID No.3 và SEQ ID N0.4 để thu được hộp gen kpnl-ATG-kozak-chIL-6-XhoI-stop, sau đó gắn hộp gen này vào vectơ pUC57/kpn bằng enzym T4-ligaza để thu được vectơ pUC57/kpn tái tổ hợp mang hộp gen kpnI-ATG-kozak-chIL-6-XhoI-stop;

d) Tạo dòng tế bào E.coli tái tổ hợp mang plasmit pUC57/chIL-6 bằng cách biến nạp vectơ pUC57/kpn tái tổ mang hộp gen kpn 1-ATG-kozak-chIL-6-Xho I-stop thu được từ bước c) vào tế bào E.coli Top10F, sau khi chọn lọc và nhân trên môi trường BL có bổ sung 1% ampixilin thu được chủng E.coli Top10F tái tổ hợp mang plasmit pUC5/chIL-6;

e) Tạo vectơ con thoi tái tổ hợp pETR3C/chIL-6 bằng cách xử lý lần lượt vectơ pENTR3C và plasmit pUC57/chIL-6 thu được từ tế bào E.coli trong bước d) bằng hai enzym giới hạn KpnI và XhoI ở 37°C trong 2 giờ, sau đó khuyếch đại gen chIL-6 bằng PCR với cặp mồi nêu trong SEQ ID NO.5 và SEQ ID NO.6 thu được trình tự của gen chIL-6 có trình tự nêu trong SEQ ID NO.2 và gắn gen chIL-6 này vào vertơ pENTR3C bằng enzym T4-ligaza trong điều kiện 14°C ủ qua đêm thu được vectơ con thoi tái tổ hợp pETR3C/chIL-6;

f) Tạo dòng tế bào E.coli DH5α mang vectơ con thoi tái tổ hợp pETR3C/chIL-6 bằng cách biến nạp vectơ con thoi tái tổ hợp pETR3C/chIL-6 vào tế bào E.coli DH5α khả biến, sau đó chọn lọc và nuôi trên môi trường BL đặc bổ sung kanamycin 50μg/ml thu được chủng E.coli DH5α mang vectơ con thoi tái tổ họp pETR3C/chIL-6;

g) Tạo plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp bằng cách gắn vectơ con thoi tái tổ hợp pETR3C/chIL-6 với vectơ pAd/CMV/V5-DEST bằng enzym LR clonase™II trong 10 phút ở 37°C để thu được plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp;

h) Tạo dòng tế bào E.coli mang plasmit pAd/CMV/V5-DEST/chIL-6 bằng cách biến nạp plasmit này vào tế bào E.coli TOP 10 khả biến, sau đó chọn lọc và nuôi trên môi trường BL đặc bổ sung ampixilin 100μg/ml thu được chủng E.coli TOP 10 mang plasmit pAd/CMV/V5-DEST/chIL-6; và

i) Thu adenovirut tái tổ hợp mang gen chIL-6 của gà bằng cách cắt plasmit pAd/CMV/V5-DEST/chIL-6 từ tế bào E.coli thu được ở bước h) bằng enzym PacI để thu đoạn pAd/CMV/V5-DEST/chIL-6, sau đó lây nhiễm vào tế bào HEK 293A bằng lipofectamin2000, nuôi tế bào trong môi trường opt-DMEM ở 37°C, 5% CO2 trong 24 giờ, sau đó chuyển sang môi trường DMEM có kháng sinh và FBS trong từ 5 đến 6 ngày thu được adenovirut tái tổ hợp mang gen chIL-6 của gà.

Adenovirut tái tổ hợp thu được theo phương pháp theo giải pháp hữu ích thích họp để kích thích miễn dịch cho gia cầm, cụ thể là cho gà.

Mô tả chi tiết giải pháp hữu ích

Sau đây, giải pháp hữu ích được mô tả chi tiết với các ví dụ và các phương án thực hiện, tuy nhiên, các ví dụ và phương án thực hiện cụ thể này chỉ nhằm mục đích bộc lộ các phương án thực hiện giải pháp hữu ích mà không nhàm hạn chế phạm vi yêu cầu bảo hộ của giải pháp hữu ích.

Trừ khi có quy định khác, các thuật ngữ được sử dụng theo giải pháp hữu ích là các thuật ngữ chung đã được thừa nhận bởi người có hiểu biết trung bình về lĩnh vực kỹ thuật này. Các tế bào chủ, plasmit, vectơ được sử dụng theo giải pháp hữu ích là các sản phẩm thương mại, ví dụ, tế bào E.coli Top10, E.coli DH5α, E.coli ccd B survival™2TlR, HEK có thể mua được từ hãng Invitrogen (US). Các vectơ nhân dòng và các enzym giới hạn cũng là các sản phẩm thương mại, ví dụ vectơ pUC 57/kpn pENTR3C (Invitrogen), enzym giới hạn KpnI, XhoI, LR clonase™II có thể mua được từ Invitrogen (US).

Các phương pháp chiết tách ADN, ARN, biến nạp, nhân dòng, phiên mã ngược được thực hiện bởi phương pháp chuẩn đã biết bởi người có hiểu biết trung bình về lĩnh vực kỹ thuật này. Các kỹ thuật này có thể được thực hiện với sự trợ giúp của các kit thương mại và được tiến hành theo hướng dẫn của nhà sản xuất.

Gen chIL-6 có trình tự nêu trong SEQ ID No. 1 là gen IL-6 được chiết từ lá lách của giống gà Lương Phượng - Sacco như sau:

Thu nhận mô lá lách của giống gà Lương Phượng - Sacco 3 tuần tuổi, sau đó chiết ARN và tiến hành phiên mã ngược bằng RT-PCR với cặp mồi ngẫu nhiên được thiết kế dựa trên trình tự bảo thủ của gen chIL-6 trong ngân hàng gen mã số AJ309540; NM_204628.1; HM179640.1. Quy trình được thực hiện theo kit cADN của Invitrogen. Sau khi thu được sản phẩm PCR, tiến hành PCR lần 2 với mẫu là cADN với cặp mồi, được thiết kế dựa trên trình tự HM179640 của IL-6 của gà trên Genbank, có trình tự sau:

chIL-6F: 5' TATCATGCTAACTTCACCGAGGGC 3' chIL-6R: 5' TCAGGGCACTGAAACTCCTGGTCTT3'

Sản phẩm PCR được giải trình tự là trình tự chIL-6 của gà Lương Phượng -Sacco. Sản phẩm này được bảo quản ở nhiệt độ đông khô -20°C. Giải trình tự sản phẩm PCR thu được trình tự bao gồm 726 bp. Trình tự này đã được đăng ký trên ngân hàng gen với mã số JQ897539, chi tiết về trình tự được nêu trong SEQ ID NO.1. Sản phẩm PCR của gen chIL-6 này được bảo quản ở -20°C tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Theo đó, giải pháp hữu ích đề cập đến quy trình sản xuất adenovirut tái tổ hợp để kích thích miễn dịch cho gà trên cơ sở trình tự gen chIL-6 và khung adenovirut giảm độc lực của hãng Invitrogen để tạo ra adenovirut tái tổ hợp mang gen chIL-6 của gà.

_ Quy trình theo giải pháp hữu ích bao gồm các bước: a) Tạo vectơ pCR2.1 tái tổ hợp; b) Tạo dòng tế bào E.coli tái tổ hợp mang gen chIL-6 của gà; c) Tạo vectơ pUC57/kpn tái tổ hợp; d) Tạo dòng tế bào E.coli. tái tổ họp mang plasmit pUC57/chIL-6; e) Tạo vectơ con thoi tái tổ hợp pETR3C/chIL-6; f) Tạo dòng tế bào E.coli DH5α mang vectơ con thoi tái tổ hợp pETR3C/chIL-6; g) Tạo plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp; h) Tạo dòng tế bào E.coli mang plasmit pAd/CMV/V5-DEST/chIL-6; và i) thu adenovirut tái tổ hợp mang gen chIL-6 của gà.

Trong bước tạo vectơ pCR2.1 tái tổ hợp, sản phẩm gen chIL-6 của gà có trình tự nêu trong SEQ ID NO.1 được gắn vào vectơ pCR2.1 của hãng Invitrogen. Quy trình gắn được thực hiện theo hướng dẫn của nhà sản xuất. Phản ứng gắn có các thành phần được tính theo 10μl như sau:

Nước cất: 5μl Dung dịch đệm cho T4-ligaza: 1μl Gen chIL-6 (sản phẩm PCR): 2μl Vectơ pCR2.1L: 1μl

Enzym T4-ligaza: 1μl

Mẫu được ủ ở 14°C trong thời gian 16 giờ. Vectơ tái tổ hợp thu được là vectơ pCR2. 1 mong muốn là vectơ được gắn gen chIL-6 có trình tự nêu trong SEQ ID No. 1.

Trong bước tạo dòng tế bào E.coli tái tổ họp mang gen chIL-6 của gà, vectơ pCR2.1 tái tổ hợp thu được ở trên được biến nạp vào tế bào E.coli Top 10F. Tế bào E.coli Top 10 là tế bào thương mại của hãng Invitrogen. Phương pháp biến nạp vào tế bào vectơ pCR2.1 tái tổ hợp vào tế bào E.coli Top 10 là phương pháp biến nạp đã biết trong lĩnh vực kỹ thuật này. Theo một phương án ưu tiên, phương pháp biến nạp này là phương pháp biến nạp bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% ampixilin thu khuẩn lạc. Các khuẩn lạc này được nuôi cây trên môi trường BL lỏng để khuyếch đại plasmit thu được chủng E.coli Top 10F tái tổ hợp mang gen chIL-6 của gà.

Để xác định việc chuyển gen thành công, plasmit được tách chiết từ chủng E. coli Top 10F tái tổ họp mang gen chIL-6 của gà và được kiểm tra bằng enzym giới hạn EcoRI. và tinh sạch bằng kit Pure Link™ của Fermentas và kiểm tra bằng điện di trên gel agaroza 1% theo hướng dẫn của nhà sản xuất. Plasmit sau khi tinh sạch được giữ ở -20oC để thực hiện các bước tiếp theo. Dòng tế bào E.coli Top 10F tái tổ hợp mang gen chIL-6 của gà được lưu giữ trong glycerol ở -80°C tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Trong bước tạo vectơ pUC57/kpn tái tổ hợp, tiến hành chiết đoạn gen chIL-6 từ chủng E.coli Top 10F tái tổ hợp thu được ở trên bằng kỹ thuật chiết chuẩn. Sau đó tiến hành PCR với cặp mồi có trình tự sau:

KzchIL6FP: TATCGGTACCGATATGGCTAACTTCACCGAGGG (SEQ ID NO.3)

KzchIL6RP: TCAGCTCGAGGGCACTGAAACTCCTGGTCTTTTTC (SEQ ID NO.4)

Tiến hành PCR với khuôn là đoạn gen chIL-6 từ chủng E.coli Top10F tái tổ hợp ở dạng plasmit pCR2.1 tái tổ hợp (ADN plasmit pCR2.l-chIL-6). Điều kiện gắn mồi được thực hiện ở nhiệt độ 64oC. Với trình tự môi này, đoạn cắt đối với enzym giới hạn KpnI và XhoI được bổ sung vào (phần gạch chân của SEQ ID NO.3 và SEQ ID NO.4, tương ứng). Điều kiện khuyếch đại để thu được hộp gen kpnI-ATG-kozak-chIL-6-XhoI-stop như sau:

PCR master mix (Promega): 5μl Khuôn (ADN plasmit pCR2.1 -chIL-6: 3μl Gen chIL-6 (sản phẩm PCR): 2μl Vectơ pCR2.1L: 1μl Enzym T4-ligaza: 1μl

KzchIL6FP: 1μl KzchIL6RP: 1μl Nước cất: 7,5μl

Sản phẩm PCR là hộp gen kpnI-ATG-kozak-chIL-6-XhoI-stop bao gồm trình tự enzym giới hạn KpnI, XhoI, trình tự kozak và trình tự kết thúc được gắn với gen chIL-6 theo lần lượt theo thứ tự đã nêu. Sản phẩm này sau đó được gắn vào vectơ pUC57/kpn (của hãng Genscrip) với thành phần phản ứng như sau:

Nước cất: 5μl Dung dịch đệm cho T4-ligaza: 1μl Sản phẩm PCR: 2μl Vectơ pUC57/kpn: 1μl

Enzym T4-ligaza:

Mẫu được ủ ở 14°C trong 16 giờ, thu được vectơ vectơ pUC57/kpn tái tổ hợp mang hộp gen kpnI-ATG-kozak-chIL-6-XhoI-stop.

Trong bước tạo dòng tế bào E.coli tái tổ họp mang plasmit pUC57/chIL-6, vectơ pUC57/kpn tái tổ họp mang hộp gen kpnl-ATG-kozak-chIL-6-XhoI-stop được biến nạp vào tế bào E.coli Top 10F bằng phương pháp biến nạp đã biết trong lĩnh vực kỹ thuật này. Theo một phương án ưu tiên, phương pháp biến nạp này là phương pháp biến nạp bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% ampixilin thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại plasmit pUC57/chIL-6 thu được chủng E.coli Top 10F tái tổ hợp mang plasmit pUC57/chIL-6.

Để xác định việc chuyển gen thành công, plasmit được tách chiết từ chủng E.coli Top 10F tái tổ hợp được kiểm tra bằng enzym giới hạn KpnI và XhoI và tinh sạch bằng kit Pure Link™ của Fermentas và kiểm tra bằng điện di trên gel agaroza 1% theo hướng dẫn của nhà sản xuất. Plasmit pƯC57/chIL-6 sau khi tinh sạch được giữ ở -20°C để thực hiện các bước tiếp theo. Dòng tế bào E.coli Top 10F tái tổ hợp mang plasmit pUC57/chIL-6 được lưu giữ trong glycerol ở -80°C tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Trong bước tạo vectơ con thoi tái tổ họp pETR3C/chIL-6, vectơ pENTR 3C thu được từ tế bào E.coli ccdB Survival™ 2T1R, là sản phẩm của hãng Invitrogen bằng phương pháp chiết chuẩn. Sản phẩm vectơ pENTR 3C và plasmit pUC51/chIL-6 được xử lý đồng thời bằng hai enzym là KpnI và XhoI ở 37°C trong 2 giờ.

Để kiểm tra phản ứng, tiến hành điện di sản phẩm cắt trên gel agaroza 1% thu được ADN của pENTR có kích thước 2300 bp và gen chIL-6 khoảng 750bp bằng kit Gel Extraction của hãng Fermentas.

Phân đoạn 750 bp được tiên hành PCR khuyếch đại nhằm kiến tạo hộp gen chIL-6, phản ứng PCR được thực hiện với đoạn môi sau:

chIL-6FP: CGGTACCGCCGCGATATGGCTAACTTCACCGA (SEQ ID NO.5) chIL-6RP: TCAGCTCGAGGGCACTGAAACTCCTGGTCTTTTTC (SEQ ID NO.6)

Hộp gen chIL-6 được giải trình tự, kết quả trình tự được nêu trong SEQ ID NO.2.

Hộp gen này được gắn vào vectơ pENTR3C bằng enzym T4-ligaza trong điều kiện 14°C ủ qua đêm thu được vectơ con thoi tái tổ hợp pETR3C/chIL-6. Thành phần để thực hiện phản ứng gắn bao gồm:

Gen chIL-6 (SEQ ID N0.2): 3μl Enzym T4-ligaza: 1μl

Dung dịch đệm T4: 1μl Vectơ pENTR3C: 1μl

Nước cất: 4μl

Sản phẩm thu được là vectơ con thoi tái tổ họp pETR3C/chIL-6. Sản phẩm này được dùng để chuyển vào tế bào E.coỉi DH5α để tạo dòng E.coli DH5α mang vectơ con thoi tái tổ họp pETR3C/chIL-6.

Trong bước tạo dòng tế bào E.coli DH5α mang vectơ con thoi tái tổ hợp pETR3C/chIL-6, tế bào E.coli DH5α của hãng Invitrogen được sử dụng để biến nạp. Kỹ thuật biến nạp được thực hiện bằng phương pháp biến nạp đã biết trong lĩnh vực kỹ thuật này. Theo một phương án ưu tiên, phương pháp biến nạp này là phương pháp biến nạp bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% kanamyxin 50μg/ml thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại vectơ con thoi tá tổ hợp pETR3C/chIL-6 thu được chủng E.coli DH5α tái tổ hợp mang vectơ con thoi tái tổ hợp pETR3C/chIL-6.

Để xác định việc chuyển gen thành công, plasmit được tách chiết từ chủng E.coli DH5α tái tổ hợp được cắt bằng enzym giới hạn KpnI và XhoI và tinh sạch bằng kit Pure Link™ của Fermentas và kiểm tra bằng điện di trên gel agaroza 1% theo hướng dẫn của nhà sản xuất. Vectơ con thoi tái tổ hợp pETR3C/chIL-(5 sau khi tinh sạch được giữ ở -20°C để thực hiện các bước tiếp theo. Dòng tế bào E.coli DH5α tái tổ hợp mang vectơ con thoi tái tổ hợp pETR3C/chIL-6 được lưu giữ trong glycerol ở -80°C tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Trong bước tạo plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp, vectơ pAd/CMV/V5-DEST là khung vectơ adenovirut, vectơ này là sản phẩm thương mại của hãng Invitrogen. Quá trình thực hiện phản ứng tạo pAd/CMV/V5-DEST/chIL-6 tái tổ hợp được thực hiện theo hướng dẫn của nhà sản xuất, cụ thể:

Lẩy 100ng ADN là plasmit pENTR3C-chIL-6 (1-7 μl) và 300ng ADN là vectơ pAd/CMV/V5- DEST (1μl), bổ sung đệm TE, pH 8,0 tới 8μl, trộn đều trong ống. Sau đó bổ sung 2 μl enzym LR clonase™ II. Trộn nhẹ và ủ hỗn dịch ở 25°C trong 1 giờ. Sau đó bổ sung vào hỗn họp 1 μl protease K và ủ trong 10 phút ở 37°C. Lúc này, phần DNA của vectơ con thoi tái tổ hợp pETR3 C/chỉL-6 sẽ được gắn vào khung vectơ pAd/CMV/V5-DEST tạo ra plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp.

Trong bước tạo dòng tế bào E.coli mang plasmit pAd/CMV/V5-DEST/chIL-6, tế bào E.coli TOP 10 khả biến của hãng Invitrogen được sử dụng để biến nạp. Kỹ thuật biến nạp được thực hiện bằng phương pháp biến nạp đã biết trong lĩnh vực kỹ thuật này. Theo một phương án ưu tiên, phương pháp biến nạp này là phương pháp biến nạp bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% ampixilin 100μg/ml thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại plasmit pAd/CMV/V5-DEST7chIL-6 tái tổ hợp thu được chủng E.coli TOP 10 mang tái tổ hợp mang plasmit pAd/CMVA/5-DEST/chIL-6.

Để xác định việc chuyển gen thành công, plasmit được tách chiết từ chủng E.coli TOP 10 tái tổ hợp bằng kit của Qiagen. Kiểm tra bằng cặp mồi đặc hiệu và điện di trên gel agaroza 1% theo hướng dân của nhà sản xuất. Plasmit pAd/CMVA/5-DEST/chIL-6 sau khi tinh sạch được giữ ở -20°C để thực hiện các bước tiếp theo. Dòng tế bào E.coli TOP 10 tái tổ hợp mang plasmit pAd/CMV/V5-DEST/chIL-6 được lưu giữ trong glycerol ở -80°C tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Trong bước thu adenovirut tái tổ hợp mang gen chIL-6 của gà, plasmit pAd/CMV/V5-DEST/chIL-6 thu được từ tế bào E.coli TOP 10 tái tổ hợp ở trên được cắt bằng enzym Pad để thu đoạn pAd/CMV/V5-DEST/chIL-6. Điều kiện thực hiện với thành phần như sau:

Nước cất: 50μl Đệm 10X: 15μl pAd/CMV/V5-DEST/chIL-6: 30μl.

Hỗn hợp trên được ủ ở 37°C trong 1 giờ. Sau khi điện di trên agaroza 1%. Thu phân đoạn giới hạn trong điểm cắt của enzym Pad chứa gen IL-6 và ADN của adenovirut (phân đoạn pAd/CMV/V5-DEST/chIL-6) mạch thẳng để tiến hành lây nhiễm vào tế bào HEK 293A.

Tế bào HEK 293A là sản phẩm thương mại của hãng Invitrogen được nuôi trong môi trường DMEM, xử lý bằng tripsin và được nuôi cấy trong các giếng để tiến hành xâm nhiễm trong điều kiện có mặt lipofectamin2000.

Lấy 4 μg phân đoạn pAd/CMV/V5-DEST/chIL-6A (còn được gọi là phân đoạn ADN-IL-6-LITR/RITR(PacI) và 250 μl môi trường MEM tối ưu (opt-MEM) đảo nhẹ để 5 phút (A). Lấy 12 μl lipofectamin2000 và 250 μl opt-MEM, đảo nhẹ để 5 phút (B). Chuyển (A) vào (B), đảo nhẹ, để ở nhiệt độ phòng 20 phút, thả nhẹ nhàng vào 1 giếng; chứa tế bào HEK 293A. Các đĩa được nuôi ở 37°C 5% CO2. Sau 24 giờ, thay môi trường DMEM có kháng sinh và FBS. Khi thấy môi trường đổi màu, thêm môi trường mới 1 lần. Hàng ngày quan sát tế bào đối chứng và sự phá hủy của virut đối với tế bào ở các giếng xâm nhiễm dưới kính hiển vi soi ngược. Sau khoảng 5 đến 6 ngày, tế bào ở mẫu bị xâm nhiễm chết, bong thành mảng ra khỏi đáy nhiều, tinh sạch thu được adenovirut tái tổ họp mang gen chIL-6 của gà.

Ví dụ thực hiện giải pháp hữu ích

Ví dụ 1. Sản xuất adenovirut mang gen chIL-6 của gà

Để sản xuất adenovirut mang gen chIL-6 của gà, các thành phần bao gồm tế bào E.coli Top10, E.coli DH5a, E.coli ccd B survival™2T1R, HEK là các tế bào mua được từ Invitrogen (US). Các vectơ nhân dòng như vectơ pCR2.1 của hãng Invitrogen, vectơ pUC 57/kpn của Genscript, pENTR3C của Invitrogen, các enzym giới hạn KpnI, XhoI, LR clonase™II mua được từ Invitrogen (US).

Sản phẩm gen chIL-6 có trình tự nêu trong SEQ ID NO.1 được chiết từ lá lách của gà và được bảo quản tại Viện Công nghệ sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam.

Tiến hành tạo vectơ pCR2.1 tái tổ hợp sản phẩm gen chIL-6 của gà, tiến hành phản ứng bao gồm các thành phần như sau:

Nước cất: 5μl Dung dịch đệm cho T4-ligaza: 1μl Gen chIL-6 (SEQID NO. 1): 2μl VectơpCR2.1L: 1μl Enzym T4-ligaza: 1μl

Mẫu được ủ ở 14°C trong thời gian 16 giờ, kết quả thu được vectơ pCR2.1 tái tổ hợp gắn gen chIL-6. Sau đó vectơ này được biến nạp vào tế bào E.coli Top 10 bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi _ trường BL có bổ sung 1% ampixilin thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại plasmit thu được chủng E.coli Top10F tái tổ họp mang gen chIL-6 của gà.

Chiết plasmit từ chủng E.coli Top10F tái tổ hợp này bằng kit Pure Link™ của Fermentas. Sau đó tiến hành PCR với điều kiện sau:

PCR master mix (Promega): 5μl

Khuôn (ADN plasmit pCR2.1-chIL-6: 3μl

Gen chIL-6 (sản phẩm PCR): 2μl

Vectơ pCR2.1L: 1μl

Enzym T4-ligaza: 1μl KzchIL6FP: 1μl KzchIL6RP: 1μl

Nước cất: 7,5μl

Tiếp đó sản phẩm PCR được gắn vào vectơ pƯC57/kpn (của hãng Genscrip) với

Tiếp đó sản phẩm PCR được gắn vào vectơ pUC57/kpn (của hãng Genscrip) với thành phần phản ứng như sau:

Nước cất: 5μl Dung dịch đệm cho T4-ligaza: 1μl Sản phẩm PCR: 2μl Vectơ pUC57/kpn: 1μl Enzym T4-ligaza: 1μl

Mẫu được ủ ở 14°C trong 16 giờ, thu được vectơ pUC57/kpn tái tổ hợp mang hộp gen kpnI-ATG-kozak-chIL-6-XhoI-stop.

Sản phẩm này được biến nạp vào tế bào E.coli Top 10F bằng sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% ampixilin thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại plasmit pUC57lchIL-6 thu được chủng E.coli Top 10F tái tổ họp mang plasmit pUC57/chIL-6.

Chiết plasmit từ chủng E.coli Top 10F tái tổ hợp trên bằng kit Pure Link™ của Fermentas. Plasmit pUC57/chIL-6 sau khi tinh sạch được tái tổ hợp vào vectơ pENTR 3C bằng cách cắt vectơ pENTR 3C và plasmit pUC57/chIL-6 được xử lý đồng thời bằng hai enzym là KpnI và XhoI ở 37°C trong 2 giờ. Sau đó khuyếch đại phân đoạn 750bp bằng cặp mồi nêu trong SEQ ID NO.5 và SEQ ID. NO.6 để thu được trình tự nêu trong SEQ ID NO.2. Sản phẩm được gắn vào vectơ pENTR3C bằng enzym T4-ligaza trong điều kiện 14°C ủ qua đêm, thành phần để thực hiện phản ứng gắn bao gồm:

Gen chIL-6 (SEQ ID N0.2): 3μl Enzym T4-ligaza: 1μl Dung dịch đệm T4: 1μl

Vectơ pENTR3C: 1μl Nước cất: 4μl

Sau đó sản phẩm được chuyển vào tế bào E.coli DH5α của hãng Invitrogen bằng phương pháp sốc nhiệt. Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi _ trường BL có bổ sung 1% kanamyxin 50μg/ml thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng thu được chủng E.coli DH5α tái tổ hợp mang vectơ con thoi tái tổ hợp pETK5C/chIL-6.

Chiết plasmit từ chủng E.coli DH5α tái tổ hợp nêu trên bằng kit Pure Link™ của Fermentas. Sau đó lấy 100ng ADN là plasmit pENTR3C-chIL-6 (1-7 μl) và 300ng ADN là vectơ pAd/CMV/V5- DEST (1μl), bổ sung đệm TE, pH 8,0 tới 8μl, trộn đều trong ống. Sau đó bổ sung 2 μl enzym LR clonaza™ II. Trộn nhẹ và ủ hỗn dịch ở 25°C trong 1 giờ. Sau đó bổ sung vào hỗn họp 1 μl proteaza K và ủ trong 10 phút ở 37°C thu được plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp.

Plasmit pAd/CMV/V5-DEST/chIL-6 đươc biến nạp vào tế bào E.coli TOP 10 khả biến của hãng Invitrogen bàng phương pháp sốc nhiệt Tế bào sau khi biến nạp được nuôi cấy chọn lọc trên môi trường BL có bổ sung 1% ampixilin 100μg/ml thu khuẩn lạc. Các khuẩn lạc này được nuôi cấy trên môi trường BL lỏng để khuyếch đại plasmit pAd/CMV/V5-DEST/chIL-6 tái tổ hợp thu được chủng E.coli TOP 10 mang tái tổ hợp mang plasmit pAd/CMV/V5-DEST/chIL-6.

Chiết plasmit từ chủng E.coli TOP 10 tái tổ hợp nêu trên bằng kit của Qiagen. Sau đó cắt bằng enzym PacI để thu đoạn pAd/CMV/V5-DEST/chIL-6. Điều kiện thực hiện với thành phần như sau:

Nước cất: 50μl Đệm 10X: 15μl pAd/CMV/V5-DEST7chIL-6: 30μl

Hỗn hợp trên được ủ ở 37°C trong 1 giờ. Sau khi điện di trên agaroza 1%. Thu phân đoạn giới hạn trong điểm cắt của enzym Pad chứa gen IL-6 và ADN của adenovirut (phân đoạn pAd/CMV/V5-DEST/chIL-6) mạch thẳng.

Lấy 4 μg phân đoạn pAd/CMV/V5-DEST/chIL-6A (còn được gọi là phân đoạn ADN-IL-6-LITR/RITR(PacI) và 250 μl môi trường MEM tối ưu (opt-MEM) đảo nhẹ để 5 phút (A). Lấy 12 μl lipofectamin2000 và 250 μl opt-MEM, đảo nhẹ để 5 phút (B).

Chuyển (A) vào (B), đảo nhẹ, đê ở nhiệt độ phòng 20 phút, thả nhẹ nhàng vào 1 giêng nuôi cấy tế bào HEK293A được chuẩn bị từ trước. Các đĩa được nuôi ở 37°C, 5% CO2. Sau 24 giờ, thay môi trường DMEM có kháng sinh và FBS. Khi thấy môi trường đổi màu, thêm môi trường mới 1 lần. Hàng ngày quan sát tế bào đối chứng và sự phá hủy của virut đôi với tế bào ở các giếng xâm nhiễm dưới kính hiển vi soi ngược. Sau 6 ngày xâm nhiễm, thu dịch nuôi cấy tế bào HEK293A và giữ các ống có dịch nuôi tế bào ở nhiệt độ - 80°C trong 30 phút, sau đó đưa về 37°C trong 15 phút để làm tan băng. Tiến hành đông tan 3 lần để phá vỡ tế bào giải phóng virut. Ly tâm ở 3000 vòng/phút trong 15 phút ở nhiệt độ phòng. Thu phần dịch ly tâm chứa adenovirut tái tổ họp mang gen chIL-6 của gà. Adenovirut này được bảo quản ở - 80°C cho đến khi sử dụng.

Vỉ dụ 2. Kiểm tra hiệu quả quả trình xăm nhiễm bằng PCR

Để kiểm tra virut tái tổ hợp có được tạo ra trong tế bào HEK293A hay không, tiến hành kiểm tra tế bào HEK293A trong ví dụ 1 nêu trên. Tiến hành tách chiết ADN tổng số từ tế bào thu được, sau đó dùng cặp mồi đặc hiệu chIL-6F và chIL-6R khuếch đại đoạn gen của chIL-6 khoảng 750 bp để kiểm tra khả năng lấy nhiễm vào tế bào HEK293A.

Trước tiên, thu huyền dịch tế bào sau 6 ngày xâm nhiễm, bổ sung vào ống Eppendorf 1,5ml, ly tâm 8000 vòng/phút trong 5 phút, thu cặn tế bào. ADN tổng số từ các tế bào này được tách bằng kit của hãng Bioneer. Tiến hành PCR với khuôn là ADN tổng số từ tế bào bị xâm nhiễm, cặp môi đặc hiệu gen chIL-6, với thành phần phản ứng gồm mẫu: 2 μl; dNTP: 2,5 μl, mồi xuôi: 1μl; mồi ngược: 1μl; MgCl2: 2,5 μl; Taq polymeraza: 0,25 μl; đệm cho tag: 0,25 μl; nướcxất: 15,5 μl. Chu trình nhiệt của PCR: 94°C - 3 phút, 30 chu kỳ của (94°C-30 giây, 64°C - 1 phút, 72°C - 1 phút 30 giây), giữ ở 4°C. Sản phẩm PCR được kiểm tra bằng điện di trên gel agaroza 1%.

Kết quả điện đi cho thấy xuất hiện vạch tương ứng với vạch 0,75 kb ở thang chuẩn. Điều đó chứng tỏ adenovirut đã xâm nhập và nhân lên trong tế bào HEK293A một cách hoàn chỉnh.

Vỉ dụ 3. Kiểm tra hiệu quả xâm nhiễm tế bào bằng phương pháp ELISA

Để kiểm tra hiệu quả xâm nhiễm vào tế bào bằng phương pháp ELISA sử dụng kit Chicken Interleukin 6 ELISA theo hướng dẫn của nhà sản xuất CUSABIO.

Bổ sung 100 μl mẫu chuẩn, mẫu trắng hoặc mẫu thí nghiệm vào giếng đã được phủ sẵn kháng thể chIL-6, phủ đĩa lại bằng tấm phủ có thể dính được, ủ trong 2 giờ ở 37°C. Loại bỏ dịch trong các giếng, không rửa.

Bổ sung 100 μl Biotin-kháng thể đã pha loãng ở nồng độ sử dụng, ủ ở 37°C trong 1 giờ. Dung dịch Biotin-kháng thể có thể bị đục. Làm ấm đến nhiệt độ phòng và trộn nhẹ nhàng cho tới khi chúng chuyển về trạng thái đồng nhất.

Hút dịch từ các giếng ra và rửa 3 lần bằng dung dịch đệm rửa. Rửa bằng cách cho vào mỗi giếng 200 μl đệm rửa, để 2 phút, sau đó loại bỏ dịch nổi bằng cách gõ nhẹ đĩa trên bồn rửa. Các giọt còn lại được loại bỏ bằng cách vỗ nhẹ đĩa trên giấy thấm. Loại bỏ hoàn toàn dung dịch.

Bổ sung 100 μl dung dịch HRP-avidin ở nồng độ cần thiết vào mỗi giếng. Phủ đĩa bằng bằng một tấm phủ mới và ủ đĩa 1 giờ ở 37°C. Rửa 05 lần bằng dung dịch rửa.

Bổ sung 90 μl cơ chất TMB vào mỗi giếng, ủ ở 37°C trong 30 phút. Giữ đĩa trong tối, tránh nhiễm và tránh thay đổi nhiệt độ.

Bổ sung 50 dung dịch dừng phản úng vào mỗi giếng khi 4 giếng có chất chuẩn ở nồng độ cao nhất chuyến hoàn toàn sang màu xanh lục, nếu không thấy hiện tượng chuyển màu thì vỗ nhẹ vào đĩa để đảm bảo hòa tan hoàn toàn.

Đo mật độ quang học của mỗi giếng trong 30 phút, sử dụng máy đọc đã cài đặt ở bước sóng 450 nm.

Kết quả so màu dung dịch tế bào HEK 293A bị xâm nhiễm cho kết quả dương tính với kháng thể chuẩn chIL-6. Do đó, quá trình xâm nhiễm được khẳng định là thành công và đã tạo ra được adenovirut tái tổ hợp mang gen chỉL-6.

Ví dụ 4. Thử nghiệm chế phẩm trên gà

Để thử nghiệm chế phẩm adenovirut trên gà, tiến hành chuẩn độ virut bằng phương pháp "úp mặt thạch", tạo ra chế phẩm với chuẩn độ đến nồng độ 106PFU/0,1ml/liều.

Gà 1 ngày tuổi được chứng nhận an toàn, sạch bệnh được nuôi đến 2 tuần tuổi không được gây miễn dịch. Các con gà con được phân ngẫu nhiên thành 4 lô, mỗi lô 30 con. Tiến hành thử nghiệm với công thức sau: Lô 1: Đối chứng; Lô 2: Tiêm chế phẩm dưới da; Lô 2: Tiêm chế phẩm trong bắp; Lô 4: Sử dụng qua đường niêm mạc. Gà được nuôi, chăm sóc bình thường và theo dõi trong 4 tuần để đánh giá các chỉ tiêu về sức khỏe. Thu huyết thanh, xác định hàm lượng kháng thể bằng ELISA theo phương pháp chuẩn.

Trong quá trình thử nghiệm, tất cả gà trong các lô đổi chứng và thí nghiệm đều khỏe mạnh, nhanh nhẹn, ăn uống bình thường, phân tốt và tăng cân tốt. Sau 1 tháng thử nghiệm, tất cả gà ở lô sử dụng adenovirut tái tổ hợp qua đường niêm mạc có trọng lượng vượt trội so với gà ở các lô thí nghiệm khác (gà ở lô sử dụng adenovirut tái tổ họp qua đường tiêm và lô đối chứng), nặng hơn từ 2-3 lạng. Bên cạnh đó, một số con gà ở lô thử nghiệm có túi fabricious và lá lách to hơn đối chứng rất nhiều.

Để xác định sự hoạt hóa của gen chIL-6, tiến hành PCR với khuôn là ADN từ trong huyết thanh gà bằng phản ứng ELISA với kháng thể chuẩn là chIL-6 cho thấy 64,7 % gà ở lô sử dụng adenovirut tái tổ hợp mang gen IL-6 có hàm lượng kháng nguyên dương tính đạt trên ngưỡng phát hiện (15,63 pg/ml), trong đó việc sử dụng qua đường niêm mạc cho hiệu quả cao nhất.

Vỉ dụ 5. Thử nghiệm so sánh với vacxin thương mại

Để thử nghiệm hiệu quả của adenovirut tái tổ hợp thu được từ Ví dụ 1, tiến hành thử nghiệm chế phẩm được tạo ra theo Ví dụ 4 để so sánh với chế phẩm vacxin LaSoTa phòng bệnh Newcastle do Xí nghiệp thuốc thú y trung ương sản xuất, bán trên thị trường.

Gà thí nghiệm một ngày tuổi tổng số là 70 con, trong đó 60 con thử nghiệm được sử dụng 2 loại chế phẩm và 10 con cho đối chứng. Đối với lô đối chứng và thử nghiệm, vacxin LaSoTa được cho gà uống lúc 7 ngày tuổi và 21 ngày tuổi. Đối với lô thử nghiệm, gây kích thích miễn dịch cho gà bằng chế phẩm theo Ví dụ 4 ở thời điểm gà 3 tuần tuổi, bằng đường niêm mạc. Gà trước lúc cho dùng LaSoTa lần 2 (lúc 21 ngày tuổi) được lấy máu thu huyết thanh kiểm tra hiệu giá HI và sau khi cho chế phẩm cytokin, kiểm tra HI ở các thời điểm 3, 7, 14 và 21 ngày. Gà sau khi thử nghiệm được thu mẫu huyết thanh; và mẫu cơ quan là lách và túi Fabricius đê kiêm tra protein cytokin (IL-6) bằng ELISA.

Huyết thanh ở tất cả các lô (kể cả đối chứng) được thu nhận ở các ngày 3, 7, 14, 21 và kiểm tra hàm lượng kháng thể Newcastle bàng phản ứng HI. thông qua hiệu giá HI trung bình biểu thị bằng giá trị log2.

Sau 1 đến 2 tuần gà được sử dụng chế phẩm theo giải pháp hữu ích cùng với vacxin LaSoTa lần 2, hiệu giá HI trung bình của lô TN1, lần lượt là 6,2 ± 0,75 và 6,7 ± 1,13; và của lô thí nghiệm TN2, lần lượt là 6,4 ± 0,63 và 6,2 ± 0,55, lớn hơn hiệu giá trung bình ở lô đối chứng (4,1 ± 1,3 và 4,8 ± 0,9) trên 2 pha log2. Đây là kết quả vượt trội, chứng tỏ quá trình đáp ứng miễn dịch với vacxin LaSoTa được tăng cường đáng kể, nếu như so với đối chứng không có sự tham gia của chế phẩm cytokin, mà chỉ thừa hưởng cytokine tự nhiên có trong cơ thể gà. Két quả ELISA (+) với cytokin ở các lô thí nghiệm cũng rất cao, ở ngày thứ 7 sau khi sử dụng chế phẩm, có 25/30 số lượng mẫu kiểm tra cho kết quả ELISA dương tính. Lô đối chứng có 01 mẫu vượt ngưỡng phát hiện (15,63 pg/ml). Như vậy, hiệu giá kháng thể (giá trị HI) của các lô thử nghiệm (gà được dùng chế phẩm theo giải pháp hữu ích với vacxin) ở giai đoạn từ 7 đến 14 ngày sau khi sử dụng đã có tác động tăng cường đáp ứng miễn dịch do vacxin mang lại. Tại ngày thứ 21 sau khi dùng chế phẩm, hiệu giá HI vẫn đạt cao (trên 5,5 log2) và cao hơn lô đối chứng 4,5log2, đảm bảo duy trì bảo hộ miễn dịch cao hơn so với gà chỉ đơn thuần dùng vacxin bình thường, không có hỗ trợ của cytokin kích thích, số mẫu có ELISA (+) với cytokin cũng giảm xuống khoảng gần 50 %.

Như vậy, khi gà được dùng kết hợp vacxin với chế phẩm adenovirut theo giải pháp hữu ích cho kết quả miễn dịch vượt trội do chúng có khả năng biểu hiện để tổng hợp một lượng cytokin bổ sung cho cơ thể gà, hỗ trợ thêm cho cytokin tự nhiên trong gà, có tác động dương tính đến quá trình đáp ứng miễn dịch.

Hiệu quả đạt được của giải pháp hữu ích

Quy trình sản xuất adenovirut tái tổ hợp theo giải pháp hữu ích có thể tạo ra được adenovirut mang gen chIL-6 của gà, adenovirut này không gây chết gà có tác dụng hỗ trợ đáp ứng miên dịch cho gà nhằm tăng cường sức đề kháng của gà với bệnh tật.

Quy trình sản xuất adenovirut tái tổ hợp theo giải pháp hữu ích có thể sản xuất được lượng lớn adenovirut mang gen chIL-6 của gà bằng phương pháp tái tổ hợp trên cơ sở nuôi cấy tế bào nên đơn giản hơn so với các quy trình sản xuất vacxin trên cơ sở vật chủ là động vật, từ đó giảm được giá thành sản xuất nhưng vẫn giữ được hiệu quả đáp ứng miễn dịch. Kết quả thử nghiệm cho thấy 64,7 % gà ở lô sử dụng adenovirut tái tổ hợp mang gen IL-6 có hàm lượng kháng nguyên dương tính đạt trên ngưỡng phát hiện (15,63 pg/ml).

10. Nội dung có thể chuyển giao

Liên hệ trực tiếp

11. Thị trường ứng dụng
12. Hình ảnh minh họa
In bài viết
Các phát minh, sáng chế khác
 
Banner
Banner home right