Trang chủ Bằng phát minh, sáng chế • Liên hệ     • Giới thiệu     • Tài liệu hướng dẫn

Phân tử axit nucleic vận chuyển thuốc hướng đích để điều trị bệnh ung thư

Cập nhật Thứ sáu - 09/06/2017 14:06 In bài viết

1. Tên sáng chế, phát minh, giải pháp:
Phân tử axit nucleic vận chuyển thuốc hướng đích để điều trị bệnh ung thư
2. Số bằng,ký hiệu: 2-0001462
3. Thuộc lĩnh vực KH&CN Công nghệ sinh học (Sáng chế)
4. Ngày công bố 26/12/2016
5. Ngày cấp 26/12/2016
6. Chủ sở hữu chính Viện Công nghệ Sinh học thuộc Viện Hàn Lâm Khoa học và Môi trường
7. Tác giả Lê Quang Huấn (VN), La Thị Huyền (VN), Nguyễn Thị Minh Huyền (VN), Nguyễn Thị Thu Thủy (VN)
8. Điểm nổi bật
Giải pháp hữu ích đề cập đến phân tử axit nucleic vận chuyển thuốc hướng đích để điều trị bệnh ung thư. Trong đó, phân tử axit nucleic này có trình tự nêu trong SEQ ID NO. 1 bao gồm phần ổn định cấu trúc và bổ trợ với mồi có trình tự nêu trong SEQID NO.2 và SEQ ID NO.3, phần có khả năng nhận biết và gắn kết với kháng nguyên HER 2 đích trên tế bào ung thư biểu mô có trình tự nêu trong SEQ ID NO.4; và phần có khả năng kích thích tăng cường đáp ứng miễn dịch có trình tự nêu trong SEQ ID NO.5. Ngoài ra, giải pháp hữu ích còn đề cập đến phức hệ vận chuyển thuốc hướng đích và phương pháp sản xuất phức hệ này.
9. Mô tả về sáng chế, phát minh, giải pháp

Lĩnh vực kỹ thuật được đề cập

Giải pháp hữu ích thuộc lĩnh vực công nghệ y sinh, cụ thể là đề cập đến phân tử axit nucleic, phức hệ dẫn thuốc để vận chuyển thuốc hướng đích để điều trị bệnh ung thư. Cụ thể là giải pháp hữu ích đề cập đến phức hệ dẫn thuốc bao gồm phân tử axit nucleic tiếp hợp với thuốc, cucurmin và chitosan để vận chuyển thuốc hướng đích đến và gắn với kháng nguyên HER2 trên tê bào ung thư để điều trị bệnh ung thư biểu mô. Ngoài ra, giải pháp hữu ích đề cập đến quy trình sản xuất phức hệ vận chuyển thuốc hướng đích chứa phân tử axit nucleic này.

Tình trạng kỹ thuật của giải pháp hữu ích

Hiện bệnh ung thư đang là một căn bệnh có tốc độ phát triển mạnh, dự kiến, tới năm 2020, tỷ lệ ung thư toàn cầu có thể tăng 50%, lên tới 15 triệu ca mới mỗi năm. Đã có nhiều phương pháp điều trị bệnh ung thư như hóa trị liệu, xạ trị với mục đích tiêu diệt các tế bào ung thư. Phương pháp hóa trị liệu được coi là một phương pháp có khả năng ngăn ngừa bệnh. Tuy nhiên, phương pháp này đều có tác dụng phụ không mong muốn và không đặc hiệu nên có nhiều tác dụng phụ do hóa chất ảnh hưởng đến các tế bào bình thường.

Để điều trị được bệnh ung thư, cần có phương pháp điều trị thích họp sao cho có khả năng tiêu diệt tế bào ác tính, nhưng không ảnh hưởng đến các tế bào bình thường. Để đạt được điều này, cần có các hệ dẫn thuốc đặc hiệu tế bào ung thư để có thể dẫn thuốc tập trung tới tế bào ung thư và tiêu diệt. Đã có nhiều nỗ lực nhằm tạo ra phản ứng miễn dịch tác động đặc hiệu tế bào khối u và được xem là phương pháp điều trị lý tưởng do tính đặc hiệu đối với các tế bào khối u và khả năng bảo hộ miễn dịch lâu dài. Ví dụ, các vacxin ung thư có thế được sử dụng để phòng ngừa và để điều trị ung thư, đặc biệt chống lại sự tái phát (xem tài liệu, Aly Hamdy A.A., 2012. Cancer therapy and vaccination. Journal of Immunological Methods. 382:1-23. Review).

Đã có nhiều nỗ lực để tạo ra các hạt nano nhân tạo hoặc tự nhiên có thể kích thích hoặc ức chế hệ miễn dịch của cơ thể. Các hạt nano nhân tạo với đặc tính hướng đích hoặc tránh sự nhận biết của hệ miễn dịch đang được sử dụng ngày càng nhiều trong chẩn đoán và điều trị bệnh (xem tài liệu Azam Bolhassani, Potential efficacy of cell-penetrating peptides for nucleic acid and drug delivery in cancer, Biochimica et Biophysica 1816 (2011) 232-246).

Hiện trên thế giới, những hệ dẫn thuốc nano được ứng dụng trong điều trị ung thư chủ yếu là các dạng liposom, mixell, v.v., được chế tạo từ các polyme tự nhiên hoặc nhân tạo, các thuốc được đóng gói trong các phức hệ này là các hóa chất có tác dụng gây độc tế bào hiện đang được sử dụng trong hóa trị liệu, như abraxan là loại thuốc cấu trúc nanno được cấu tạo bởi albumin và paclitaxel được Cục quản lý Thực phẩm và Dược phẩm Hoa Kỳ (Food and Drug Administration: FDA) chấp thuận để sử dụng trong điều trị ung thư vú và ung thư phổi (ví dụ, xem: Paclitaxel (Abraxane)". U.S. Food and Drug Administration. 11 October 2012. Retrieved lo December 2012). Đã biết một số thuốc đã được sử dụng, ví dụ, VivaGel của Star phamar, đang thử nghiệm ở pha II đối với nhiễm HIV; Cyclosertcamptothecin (cyclodextrin nanoparticle) được sử dụng trong điều trị các khối u di căn, TNT AntiEpCA được sử dụng trong điều trị các khối u rắn, v.v. (ví dụ, xem: Ghune M and Jain DK., Nano-medicine based drug delivery system Akash Yadav. Journaỉ of Advanced Pharmacy Education & Research 1(4): 201-213 (2011) ISSN 2249-3379); Tuy nhiên, các loại thuốc này có hiệu quả không cao do tính hấp thụ thụ động, hoặc chưa được chứng minh rõ ràng hiệu quả đối với bệnh ung thư.

Một xu hướng được quan tâm nghiên cứu hệ dẫn thuốc điều trị ung thư, đó là các hệ dẫn thuốc có bản chất là các axit nucleic do khả năng tương thích sinh học, khả năng phân rã sinh học đông thời có thể liên kết với các yếu tố hướng đích tới các chỉ thị đặc hiệu trên tế bào ung thư (ví dụ, xem: Thi Huyên La, Thi Thu Thuy Nguyen, Van Phuc Pham, Thi Minh Huyen Nguyen and Quang Huan Le Using DNA nanotechnology to produce a drug delivery system. Adv. Nat. Sci.: Nanosci. Nanotechnol. 4 (2013) 015002 (7pp) doi: 10.1088/2043-6262/4/1/015002).

Ngoài tính chất tiềm năng kích thích miễn dịch dựa trên khả năng kích hoạt phản ứng miễn dịch bẩm sinh và phản ứng miễn dịch thích ứng, các hạt nano trên cơ sở axit nucleic có khả năng làm tăng tính kháng nguyên của các kháng nguyên yếu và do đó phục vụ như là chất hỗ trợ tăng cường miễn dịch vì chính ngay bản thân một số hạt nano đã được chứng minh cũng tác động như những kháng nguyên.

Khả năng bảo vệ và giải phóng các kháng nguyên tại vị trí mong muốn trong điều kiện in vivo là đặc tính quan trọng của các phức hệ vận chuyển thuốc. Vì vậy, các phức hệ vận chuyển thuốc mang kháng nguyên được sử dụng để phát triển các vacxin thế hệ mới. Trong đó các phức hệ nano polyme hoặc phức hệ nano lipit mang các kháng nguyên đặc hiệu được đặc biệt quan tâm trong cả hướng nghiên cứu ức chế và tăng cường miễn dịch (xem tài liệu: Rattanakiat S, Nishikawa M, Takakura Y, (2012). Self-assembling CpG DNA nanoparticĩes for effĩcient antigen delivery and immunostimulation. European Journal of Pharmaceutical Sciences 47: 352-358; Mizuno Y, Naoi T, Nishikawa M, et al., (2010). Simultaneous delivery of doxorubicin and immunostimulatory CpG motif to tumors using a plasmid DNA/doxorubicin complex in mice. J. Controlled Release, 141:252-259).

Do các thuốc điều trị ung thư theo liệu pháp hóa trị thường không tan trong nước, nên cần có những phức hệ vận chuyển để làm tăng tính hòa tan của thuốc đồng thời giảm tác dụng phụ của thuốc. Tuy nhiên, để đạt được hiệu quả tác dụng tối đa của thuốc cần phải có phức hệ vận chuyển thuốc hướng đích.

Đe các hệ vận chuyển và phân phối thuốc tới các vị trí đích hiệu quả cần có các phân tử hướng đích được gắn lên bề mặt của các phức hệ. Các phân tử có khả năng hướng đích được các nhà khoa học đặc biệt quan tâm là các kháng thể đơn dòng hoặc các aptamer có khả năng nhận biết và gắn kết đặc hiệu vói các chỉ thị khối u trên các tế bào ung thư (xem tài liệu: Smith, LE.; Medley, C.D.; ETAL., (2007). Aptamer-conjugated nanoparticles for the collection and detection of multiple cancer cells, Anal. Chem., 79, 3075-3082; Yanrong Wu, et al. (2009). DNA aptamer-micelle as an efficient detection/delivery vehicle toward cancer cells. PNAS, 107 (1): 5-10).

Aptamer là các sợi đơn ADN, các phân tử ARN hoặc các đoạn peptide có cấu trúc đặc biệt và có khả năng gắn kết với các phân tử đích khác nhau, chẳng hạn như các phân tử hữu cơ nhỏ, các protein và các tế bào ung thư. Cơ sở để nhận biết các phân tử đích của các aptamer là cấu trúc bậc 4 được hình thành bởi các sợi đơn nucleotit. Các aptamer đặc hiệu với phân tử đích nhận được sau chu trình chọn lọc in vitro trên phân tử đích, gọi là quá trình SELEX (systematic evolution of ligands by exponential enrichment), trong đó các aptamer được chọn lọc từ thư viện tổng hợp các sợi đơn ADN hoặc ARN (xem tài liệu: Tuerk c, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 ADN polymerase. Science 249: 505-510; Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346: 818-822; Shangguan D, Li Y, Tang Z, Cao ZC, Chen HW, et al. (2006) Aptamers evolved from live cells as effective molecular probes for cancer study. Proc Natl Acad Sci (U s A) 103:11838-11843).

Phức hệ vận chuyển thuốc hướng đích tới các tể bào ung thư được tạo ra từ các phân tử ADN và thuốc điều trị ung thư docetaxel (xem tài liệu, Huyen Thi La et al., 2013. Using DNA nanotechnology to produce a drug delivery system. Adv. Nat. Sci.: Nanosci. Nanotechnol. 4(2013) 015002 (7pp)), là phức hệ vận chuyển thuốc tới tế bào ung thư nhờ có phần aptamer hướng đích và các phân tử thuốc được gắn kết bởi các phân tử ADN nên các phân tử thuốc ở dạng phức hệ được bảo vệ tốt hơn khi chúng ở dạng tự do. Hơn nữa, khi các phân tử thuốc ở dạng phức hệ chúng sẽ được giả phóng ỏ' vị trí tế bào đích và tại đây chúng sẽ tác động với tế bào đích do vậy giảm được tác dụng phụ không mong muốn.

Một trong các vật liệu sinh học được sử dụng để tạo hệ dẫn thuốc hướng đích được sử dụng như các polyme tự nhiên và polyme nhân tạo, các phân tử lipit, các phân tử chitosan với kích thước khác nhau. Trong đó chitosan là một polyme polycationic có khả năng phân huy sinh học không gây độc và ít gây ra các phản ứng miễn dịch (xem tài liệu: Arai K., Kunumaki T. and Fujita T., (1968). Toxicity of chitosan. Bull. Tokai Reg. Fis. Lab., 43:89-94; Carrero-Gomes B. and Duncan R., (1997). Evaluation of the biological properties of soluble chitosan and chitosan microspheres. Int. J. Pharm., 148:131-140.). Chitosan là một vật liệu được ưa thích để tạo hệ dẫn các vật liệu di truyền trong liệu pháp gen, bởi chitosan tích điện dương có thể liên kết tĩnh điện với các phân tử ADN tích điện âm. Nhiều kết quả đã ứng dụng thành công chitosan trong liệu pháp gen (xem tài liệu: Leong KW., Mao HQ., Truọng-Le VL., Roy K., Walsh SM. and August JT., (1998). DNA-polycation nanospheres as non-viral gene delivery vehicles. J. Cont. ReL,53:183-193; Koping-Hoggard M, Nilsson M., Edwards K. and Artursson P., (1998). Chitosan-DNA polyplex: A new efficient, biodergradable gene delivery system. Proceed. Int. Symp. Contr. Rel. Bioact. Mater., 25:368-369). Chitosan có thể gắn kết rất hiệu quả với ADN và bảo vệ ADN khỏi các phân hủy do nucleaza (xem tài liệu: Aral C, Ozbas-Turan s., Kabasakal L., Keyer-Uysal M. and Akbuga J., (2000). Studies of effective factors of plasmid DNA-loaded chitosan microspheres: I. Plasmid size, chitosan concentration and plasmid addition techniques. STP Pharm. Soi., 10:83-88). Các vi hạt chitosan chứa ADN có tính ổn định cao trong quá trình bảo quản và hiệu quả chuyển nạp ADN của chitosan là rất hiệu quả.

Như vậy, cho đến nay các phức hệ vận chuyển thuốc tới các tế bào ung thư đích có thể được chế bào từ các polyme tự nhiên hoặc nhân tạo, chúng có thể là các lipit, chitosan, ADN, hoặc vật liệu sinh học bất kỳ có sự tương thích sinh học cao và các sản phẩm phân hủy của chúng không gây độc đều có thể được sử dụng làm nguyên liệu vận chuyển thuốc. Hơn nữa, các phức hệ vận chuyên thuôc này còn được gắn thêm các phân tử hướng đích là các kháng thể hoặc các aptamer để tăng hiệu quả điều trị của thuốc và giảm các tác dụng phụ không mong muốn. Tuy nhiên, tác dụng tăng cường đáp ứng miễn dịch của các phức hệ vận chuyển thuốc nêu trên đều không có tác dụng gây đáp ứng miễn dịch, hay nói đúng hơn các phức hệ vận chuyển thuốc hướng đích hiện nay chưa có hoạt tính của một vacxin phòng ngừa bệnh ung thư tái phát. Cho đến nay chưa có công trình công bố nào về phức hệ vận chuyển thuốc có được cả 2 đặc tính điều trị hiệu quả và tăng cường đáp ứng miên dịch để phòng ngừa ung thư tái phát và nguyên liệu chế tạo phức hệ là ADN.

Do đó, cần có phân tử dẫn thuốc cũng như phức hệ vận chuyển thuốc hướng đích đặc hiệu để phòng ngừa và điều trị bệnh ung thư, ngoài ra phân tử này cần có khả năng tương thích sinh học và ổn định.

Bản chất kỹ thuật của giải pháp hữu ích

Nhằm giải quyết các vấn đề nêu trên, giải pháp hữu ích đề cập đến phân tử axit nucleic, phức hệ vận chuyển thuốc hướng đích để điều trị bệnh ung thư biểu mô và quy trình sản xuất phức hệ vận chuyển thuốc hướng đích này.

Theo khía cạnh thứ nhất, giải pháp hữu ích đề cập đến phân tử axit nucleic vận chuyên thuốc hướng đích để điều trị bệnh ung thư biểu mô, trong đó phân tử này có trình tự nêu trong SEQ ID NO. 1 bao gồm:

- phần ổn định cấu trúc và bổ trợ với mồi có trình tự nêu trong SEQ ID NO.2 và SEQ ID N0.3; - phần có khả năng nhận biết và gắn kết với kháng nguyên HER2 đích trên tế bào ung thư biểu mô có trình tự nêu trong SEQ ID NO.4; và - phần có khả năng kích thích tăng cường đáp ứng miễn dịch có trình tự nêu trong SEQ ID NO.5.

Theo một phương án ưu tiên, phân tử axit nucleic theo giải pháp hữu ích có khả năng tiếp hợp và vận chuyển thuốc đến và gắn với kháng nguyên HER2 trên đích tế bào ung thư biểu mô được chọn từ nhóm bao gồm tế bào ung thư vú, tế bào ung thư buồng trứng, tế bào ung thư phổi và tế bào ung thư tiền liệt tuyến.

Theo khía cạnh thứ hai, giải pháp hữu ích đề cập đến phức hệ vận chuyển thuốc hướng đích, phức hệ này bao gồm phân tử axit nucleic theo giải pháp hữu ích được tiếp hợp với thuốc điều trị bệnh ung thư, cucurmin và chitosan để vận chuyển thuốc này đến và gắn với kháng nguyên HER2 trên tế bào ung thư biểu mô bao gồm tế bào ung thư vú, tế bào ung thư buồng trứng, tế bào ung thư phổi và tế bào ung thư tiền liệt tuyến.

Theo một phương án ưu tiên, phức hệ vận chuyển thuốc hướng đích theo giải pháp hữu ích để vận chuyển thuốc, trong đó thuôc điêu trị bệnh ung thư là doxorubicin hoặc docetaxel.

Theo khía cạnh thứ ba, giải pháp hữu ích đề cập đến quy trình sản xuất phức hệ vận chuyển thuốc hướng đích theo giải pháp hữu ích, trong đó quy trình này bao gồm các bước:

a) tổng hợp phân tử axit nucleic ái lực với HER2 bằng cách tiến hành PCR với các đoạn nucleotit có trình tự nêu trong SEQ ID NO.6, SEQ ro NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.ll, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO. 14, SEQ ID NO. 15 và SEQ ID NO.16, sau khi tinh sạch, sản phẩm PCR được gắn vào vectơ tách dòng PCR®2.1-TOPO và nhân lên trong tế bào Escherichia coli DHa, sau đó chiết thu được phân tử axit nucleic ái lực với HER2;

b) tạo phân tử ADN vận chuyển thuốc hướng đích bằng cách tiến hành PCR với cặp mồi có trình tự nêu trong SEQ ID No. 17 được gắn biotin và khuôn là phân tử axit nucleic ái lực với HER2 thu được từ bước a), sau khi tinh sạch, biến tính sản phẩm ở 94°C trong 10 phút và làm lạnh ngay ở 4°C rồi đưa qua cột sắc ký chứa streptavidin thu được phân tử ADN vận chuyển thuốc hướng đích có trình tự nêu trong SEQ ID NO.1;

c) tạo phức hệ vận chuyển thuốc bằng cách ủ phân tử ADN sợi đơn thu được ở bước b) với dung dịch chứa thuốc và curcumin trong 24 giờ và ly tâm trong 10 phút ở tốc độ 10.000 vòng/phút thu chất kết tủa màu đỏ đậm là phức hệ vận chuyển thuốc với đích là kháng nguyên HER2 trên tế bào ung thư biểu mô chứa thuốc/cucumin; và

d) ổn định phức hệ vận chuyển thuốc bằng cách hòa phức hệ vận chuyển thuốc thu được ở bước c) với dung dịch natri sulphat với nồng độ 20%, sau đó nhỏ vào dung dịch chitosan 0,25% trong điều kiện khuấy với tốc độ 500 vòng/phút trong 10 phút, sau đó ly tâm thu sản phẩm kết tủa thu được phức hệ vận chuyển thuốc hướng đích.

Theo một phương án ưu tiên, thuốc được tạo phức hệ với phân tử ADN sợi đơn theo quy trình là doxorubicin hoặc docetaxel.

Mô tả vắn tắt các hình vẽ

Hình 1: Cấu trúc không gian của phân tử axit nucleic vận chuyển thuốc hướng đích theo giải pháp hữu ích được xác định bằng phần mềm MFOLD.

Hình 2: Ảnh chụp phức hệ vận chuyển thuốc hướng đích trên kính hiến vi truyền qua (TEM).

Hình 3: Ảnh chụp phức hệ vận chuyển thuốc hướng đích trên kính hiển quét (SEM).

Hình 4: Kết quả thế Zeta của phức hệ vận chuyển thuốc hướng đích doxorubicin và curcumin bằng thiết bị Malvern ZetaSizer Ver.6.20 (Malvern Instruments).

Hình 5: Ảnh chụp tế bào ung thư biểu mô hấp thụ phức hệ vận chuyển thuốc hướng đích doxorubicin và curcumin trên kính hiển vi huỳnh quang đồng tiêu.

Mô tả chi tiết giải pháp hữu ích

Sau đây, giải pháp hữu ích được mô tả chi tiết với các ví dụ và các phương án thực hiện, tuy nhiên, các ví dụ và phương án thực hiện này chỉ nhằm mục đích minh họa cho các phương án cụ thể của giải pháp hữu ích mà không nhằm hạn chế phạm vi yêu cầu bảo hộ của giải pháp hữu ích.

Trừ khi có quy định khác, các thuật ngữ được sử dụng theo giải pháp hữu ích là các thuật ngữ chung đã được thừa nhận bởi người có hiểu biết trung bình vê lĩnh vực kỹ thuật này. Các đoạn mồi, trình tự oligo nucleotit được sử dụng để tổng hợp phân từ axit nucleic theo giải pháp hữu ích là các sản phẩm thương mại hoặc tổng hợp nhân tạo, ví dụ, các trình tự nucleotit bằng các phương pháp đã biết trong lĩnh vực kỹ thuật này hoặc được mua từ các hãng như Genscript hoặc Invitrogen.

Các phương pháp chiết tách ADN, biến nạp, nhân dòng, chiết tách được thực hiện bởi phương pháp chuẩn đã biết bởi người có hiểu biết trung bình về lĩnh vực kỹ thuật này. Các kỹ thuật này có thể được thực hiện với sự trợ giúp của các kit thương mại và được tiến hành theo hướng dẫn của nhà sản xuất.

Theo đó, giải pháp hữu ích đề cập đến phân tử axit nucleic vận chuyển thuốc hướng đích để điều trị bệnh ung thư biểu mô và quy trình sản xuất phân tử axit nucleic vận chuyển thuốc hướng đích này.

Theo khía cạnh thứ nhất, giải pháp hữu ích đề cập đến phân tử axit nucleic vận chuyển thuốc hướng đích để điều trị bệnh ung thư biểu mô, trong đó phân tử này có trình tự nêu trong SEQ ID NO. 1 bao gồm:

- phần ổn định cấu trúc và bổ trợ với mồi có trình tự nêu trong SEQ ID N0.2 và SEQ ID NO.3;

- phần có khả năng nhận biết và gắn kết với kháng nguyên HER 2 đích trên tế bào ung thư biểu mô có trình tự nêu trong SEQ ID NO.4; và - phần có khả năng kích thích tăng cường đáp ứng miễn dịch có trình tự nêu trong SEQ ID NO.5.

Trình tự SEQ ID NO.1 bao gồm 270 nucleotit sợi đơn được tự cuộn với nhau tạo ra cấu trúc mạch vòng như sơ đồ nêu trong hình 1 với ba phần khác có chức năng riêng, đặc trưng cho mỗi vùng bao gồm phần ổn định, phần có khả năng nhận biết và gắn kết với kháng nguyên và phân có khả năng kích thích tăng cường đáp ứng miễn dịch.

Phần ổn định cấu trúc và bổ trợ với mồi là vùng đầu và phần cuối của phân tử axit nucleic có trình tự nêu trong SEQ ID NO.1, phần này chứa đoạn mồi có thể khuyếch đại toàn bộ phân tử dài 270 nucleitit bao gồm các nucleotit từ vị trí số 1 đến vị trí số 26 (SEQ ID NO.2) và các nucleotit từ vị trí 250 đến 270 (SEQ ID NO.3).

Phần có khả năng nhận biết và gắn kết với kháng nguyên HER2 đích trên tế bào ung thư biểu mô, còn được gọi là trình tự aptamer, phần này sẽ tạo nên cấu trúc lặp STEM (STEM-LOOP) bao gồm các nucleotit từ vị trí 205 đến vị trí 249 (SEQ ro NO.4) của trình tự nêu trong SEQ ID NO.1

Phần có khả năng kích thích tăng cường đáp ứng miễn dịch bao gồm các nucleotit từ vị trí 26 đến vị trí 204 (SEQ ID NO.5) của trình tự nêu trong SEQ ID NO.1.

Trên cơ sở nghiên cứu kháng nguyên HER2, các tác giả đã tạo ra trình tự nucleotit có khả năng gắn kết với kháng nguyên HER2 có trên bề mặt tế bào ung thư biểu mô được chọn từ nhóm bao gồm tế bào ung thư vú, tế bào ung thư buồng trứng, tế bào ung thư phổi và tế bào ung thư tiền liệt tuyến. Theo đó trình tự nucleotit này gắn đặc hiệu với kháng nguyên HER2 thông qua phần có trình tự nêu trong SEQ ID NO.4. Ngoài ra, phần có khả năng kích thích tăng cường đáp ứng miễn dịch có khả năng tiếp họp với curcumin và thuốc. Theo cách đó, phân tử nucleotit này có khả năng gắn với curcumin, thuốc, vừa có khả năng gắn kết đặc hiệu với kháng nguyên HER2 trên tế bào ung thư. Do đó, thuốc được vận chuyển đến đích để tiêu diệt tế bào ung thư. Theo phương án ưu tiên, tế bào ung thư là tế bào biểu hiện kháng nguyên HER2, cụ thể là tế bào ung thư biểu mô được chọn từ nhóm bao gồm tế bào ung thư vú, tế bào ung thư buồng trứng, tế bào ung thư phổi và tế bào ung thư tiền liệt tuyến.

Theo khía cạnh thứ hai, giải pháp hữu ích đề cập đến phức hệ vận chuyển thuốc hướng đích, phức hệ này bao gồm phân tử axit nucleic có trình tự nêu trong SEQ ID NO. 1 được tiếp hợp với thuốc điều trị bệnh ung thư, cucurmin và được bao để làm ổn định thuốc trong chitosan để vận chuyển thuốc này đến và gắn với kháng nguyên HER2 trên tế bào ung thư biểu mô. Theo phương án ưu tiên, tế bào ung thư là tế bào biểu hiện kháng nguyên HER2, cụ thể là tế bào ung thư biểu mô được chọn từ nhóm bao gồm tế bào ung thư vú, tế bào ung thư buồng trứng, tế bào ung thư phổi và tế bào ung thư tiền liệt tuyến.

Theo một phương án ưu tiên, phức hệ vận chuyển thuốc hướng đích theo giải pháp hữu ích để vận chuyển thuốc, trong đó thuốc điều trị bệnh ung thư là doxorubicin hoặc docetaxel.

Theo khía cạnh thứ ba, giải pháp hữu ích đề cập đến quy trình sản xuất phức hệ vận chuyển thuốc hướng đích theo giải pháp hữu ích, trong đó quy trình này bao gồm các bước a) tổng hợp phân tử axit nucleic ái lực với HER2; b) tạo phân tử ADN vận chuyển thuốc hướng đích; c) tạo phức hệ vận chuyển thuốc; và d) ổn định phức hệ vận chuyển thuốc.

Trong bước tổng hợp phân tử axit nucleic ái lực với HER2, phân tử axit nucleic nàv dược tổng họp bằng cách tiến hành PCR với các đoạn nucleotit có trình tự nêu trong SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO. 10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ro NO.14, SEQ ID NO.15 và SEQ ID NO. 16. Sản phẩm PCR tinh sạch được gắn vào vectơ tách dòng PCR®2.1-TOPO và nhân lên trong tế bào Escherichia coli DHa, sau đó chiết thu được phân tử axit nucleic ái lực vói HER2.

Trong bước tạo phân tử ADN vận chuyển-thuốc hướng đích. phân tử nàv được tạo ra bằng cách tiến hành PCR với cặp mồi có trình tự nêu trong SEQ ID No. 17 được gắn biotin ở một đầu và khuôn là phân tử axit nucleic ái lực với HER2 thu được ở trên. Sau khi tinh sạch, biến tính sản phẩm ở 94°C trong 10 phút và làm lạnh ngay ở 4°C rồi đưa qua cột sắc ký chứa streptavidin thu được phân tử ADN vận chuyển thuốc hướng đích có trình tự nêu trong SEQ ID NO. 1.

Trong bước tạo phức hệ vận chuyển thuốc, tiến hành ủ phân tử ADN sợi đơn thu được trên với dung dịch chứa thuốc và curcumin trong 24 giờ. Theo các phương án ưu tiên, thuốc được sử dụng là doxorubicin hoặc docetaxel có tác dụng tiêu diệt tế bào ung thư. Sản phẩm được ly tâm 10 phút với tốc độ 10.000 vòng/phút, thu chất kết tủa màu đỏ đậm là phức hệ vận chuyển thuốc với đích là kháng nguyên HER2 trên tế bào ung thư biểu mô chứa thuốc/cucumin.

Trong bước ổn định phức hệ vận chuyển thuốc, phức hệ thu được ở trên được hòa với dung dịch natri sulphat với nồng độ 20%, sau đó nhỏ vào dung dịch chitosan 0,25% trong điều kiện khuấy với tốc độ 500 vòng/phút trong 10 phút, sau đó ly tâm thu sản phẩm kết tủa thu được phức hệ vận chuyển thuốc hướng đích.

Ví dụ thực hiện giải pháp hữu ích

Ví dụ 1. Tổng hợp phân tử axit nucleic vận chuyển thuốc hướng đích

Phân tử axit nucleic được tổng hợp bằng PCR với các phân tử oligo sau có trình tự nucleotit như sau:

Các oligo từ mồi 6 đến mồi 16 được đặt trong cùng một ống eppendofit và được tiến hành PCR với chu trình nhiệt như sau: 1 chu kỳ 94°C thời gian 30 giây, 25 chu kỳ (94°C thời gian 30 giây, 58°C thời gian 30 giây, 72°C thời gian 45 giây), 1 chu kỳ 72°C thòi gian 2 phút, giữ ở 4°C.

Sản phẩm PCR được tinh sạch bằng KIT tinh sạch PCR của Hãng Invitrogen, mã số K3100-01, sau đó được eắn vào vectơ tách dòng PCR®2.1-TOPO của hãng Invitrogen và được nhân lên trong tế bào Escherichia coli chủng DHα. ADN plasmit chứa gen tái tổ hợp được chiết và tinh sạch bằng KIT của hãng QIAGEN thu được phân tử axit nucleic sợi đơn.

Sản phẩm sau khi tinh sạch được sử dụng làm khuôn trong PCR với cặp môi là SEQ ID NO 10 và SEQ ID NO.17 sau, trong đó SEQ ID NO.17 được gắn Biotin.

GGATCCCAGTCAGTTTTTAC SEQ ID NO. 10

CTCGAGGGATCCACCAAAAACCA SEQ ID NO. 17

Chu trình nhiệt như sau: 1 chu kỳ 94°C thời gian 30 giây, 25 chu kỳ (94°C thời gian 30 giây, 58°C thời gian 30 giây, 72°C thời gian 45 giây), 1 chu kỳ 72°C thời gian

2 phút, giữ ở 4°C.

Sản phẩm sau khi sạch bằng QIAquick PCR Purification Kit của hãng Qiagen theo hướng dẫn của nhà sản xuất và biến tính sản phẩm tinh sạch bằng cách đưa về 94°C trong 10 phút và chuyển ngay về 4°C. Sau đó đưa qua cột sắc ký chứa streptavidin. Chất chảy qua cột thu nhận được là các phân tử axit nucleic sợi đơn. Dung dịch qua cốt được biến tính ở 94°C trong 5 phút, sau đó làm lạnh từ từ về nhiệt độ phòng để thu nhận các phân tử axit nucleic có cấu hình không gian tự nhiên.

Sản phẩm axit nucleotit vận chuyển thuốc hướng đích thu được có trình tự nêu trong SEQ ID NO.1 và cấu trúc được xác định bằng phần mềm MFOLD. Kết quả xác định cấu trúc của axit nucleic được thể hiện trên Hình 1.

Ví dụ 2. Đóng gói và xác định cấu trúc của phức hệ vận chuyển thuốc hướng đích

Đóng gói doxorubicin với phân tử axit nucleic theo giải pháp hữu ích

Dung dịch chứa doxorubicin (2 mM) và curcumin (2 mM) được ủ với các phân tử axit nucleic thu được ở Ví dụ 1 (2,5 nM) trong thời gian 24 giờ ở nhiệt độ phòng, sau đó ly tâm 10.000 vòng/phút thời gian 10 phút. Sau khi ly tâm, chất kết tủa mầu đỏ đậm và dịch ly tâm chứa doxorubicin tự do trong dịch ly tâm được phân tách và xác định ở 480 nm trên máy đo huỳnh quang (TECAN, Infinite M200, Switzerland).

Xác định hình thái cấu trúc phức hệ thuốc bằng kính hiển vi điện tử truyền qua (TEM)

Đe xác định cấu trúc phức hệ thu được, tiến hành kiểm tra trên kính hiển vi điện tử truyền qua (TEM) với hệ thống kính hiển vi điện tử JEM1010 - JEOL, dòng điện sử dụng là 100 kV. Mẫu xác định được hòa trong dung dịch 0.5% DMSO, một giọt mẫu được đặt trong ống đồng mắt lưới 200-mesh phủ cacbon. Khoảng 2 phút sau khi làm khô, mắt lưới được xử lý với dung dịch 5% uranyl acetate solution. Mau được làm khô trước khi đo. Kết quả được thể hiện trên Hình 2.

Xác định cấu trúc phức hệ bằng kính điện tử quét (SEM)

Để khẳng định cấu trúc phức hệ thu được, tiến hành kiểm tra sản phẩm bằng kính hiển vi điện tử quét (SEM) bằng cách hòa phức hệ thu được trong 50 µg/mL và làm khô qua đêm. Hình thái phức hệ được quan sát dưới kính hiển vi điện tử quét (SEM) (S-4800: M: x25 - x800.000, 8 = 1nm, U= 0,5-30kV). Kết quả được thể hiện trên Hình 3.

Theo đó, đã khẳng định được khả năng liên hợp của phân tử axit nucleic với doxorubicin và curcumin để tạo ra phức hệ chứa thuốc điều trị bệnh ung thư.

Ổn định phức hệ bằng chitosan

Hòa tan phức hệ thu được ở trên với natri sulphat với nồng độ 20% (w/v) rồi nhỏ giọt vào dung dịch 0,25% chitosan, tốc độ khuấy 500 vòng/phút, thời gian 1 giờ. Các hạt nano hình thành được phân tách bằng ly tâm tốc độ với tốc độ 12000 vòng/phút, thời gian 10 phút. Sản phẩm kết tủa sau ly tâm được bảo quản ở 4°C để thử nghiệm khả năng vận chuyển thuốc đến tế bào ung thư.

Để kiểm tra khả năng ổn định thuốc, tiến hành đánh giá thông qua khả năng phân tán trong phức hệ dựa vào thế Zeta. Sản phẩm thu được ở ở trên được hòa trong trong nước với nồng; độ 0,5 ms/µL và chuyển vào các ống mao quản để đo thế Zeta và kích thước của phức hệ trên máy Malvem ZetaSizer Ver.6.20 (Malvern Instruments). Thế Zeta và kích thước phức hệ được thể hiện trên Hình 4.

Kiểm tra hiệu quả tạo phức hệ - chitosan và tốc độ giải phóng phân tử ADN

Phân tử ADN được kiểm tra bằng điện di trên gel agaroza 0,8% (w/v) trong đệm TBE, pH=8,3 (tri-axit boric-EDTA) và ethidium bromit (0,5 mg/mL) với hiệu điện thế ổn định là 80 V. Băng ADN được quan sát dưới đèn tia cực tím để định tính, xác định sự có mặt của ADN. Định lượng ADN được thực hiện bằng phổ hấp thụ trên thiết bị đo NanoDrop-1000 (Canada).

Hiệu quả tạo phức hệ -chitosan được tính theo tỉ lệ phần trăm lượng ADN được sử dụng ban đầu khi tạo phức hệ so với lượng ADN tự do, là lượng ADN còn lại ỏ' dịch ly tâm (xác định ADN bằng thiết bị NanoDrop-1000) trong bước tạo phức hệ dẫn thuốc hướng đích đã nêu ở trên.

Xác định tốc độ giải phóng ADN khỏi phức hệ dẫn được thực hiện như sau: phức hệ dẫn thuốc được pha trong đệm PBS, pH=7,4 ở nhiệt độ 37,4±0,5°C, và thu mẫu được thực hiện theo các mốc thời gian nhất định, ly tâm các mẫu thu với tốc độ 12000 vòng/phút, thời gian 10 phút. Xác định lượng ADN tự do trong dịch ly tâm và lượng; chitosan trong cặn ly tâm. Tốc độ gai phóng ADN khỏi phức hệ được xác định dựa trên kết quả định lượng ADN giải phóng vào dịch ly tâm ở các khoảng thời gian đã thu mẫu.

Kết quả cho thấy, phức hệ - chitosan liên kết ổn định, điều này cho thấy việc ổn định phức hệ bằng chitosan có hiệu quả, đáp ứng yêu cầu bảo quản và sử dụng phức hệ để điều trị bệnh ung thư.

Ví dụ 3. Xác định khả năng hấp thụ của tế bào ung thư đối với phức hệ vận chuyển thuốc hướng đích

Sản phẩm thu được ở trên được ủ với tế bào ung thư vú BT474 là dòng tế bào biểu hiện mạnh yếu tố phát triển biểu mô HER2. Tế bào BT474 được nuôi trong các giếng của khay nuôi 12 giếng với môi trường chuẩn DMEM (Dulbecco's Modified Eagle Medium), 10% FBS, 1% PS. Lượng tế bào: 2x105 tb/1ml/giếng (khay nuôi 12 giếng) theo các bước như sau: Nuôi tế bào trong môi trường DMEM, 10% FBS, 1% PS. Cấy chuyển tế bào sang khay 12 giếng với nồng độ 5x104 tế bào/mL, mỗi giếng 1mL. Nuôi tế bào ở 37°C, thời gian 24 giờ, sau đó thay môi trường có bổ sung thuốc hướng địch đã tạo ra và kiểm tra ở các ví dụ trên với các nồng độ khác nhau: 0,4; 0,6; 0,8; 1,6 và 3,2 mM và pha trong dung dịch 0,5% DMSO (dimethyl sulfoxit). Sau đó, tế bào được thu nhận bằng ly tâm và rửa với đệm PBS và quan sát dưới kính hiển vi huỳnh quang để đánh giá khả năng hấp thụ thuốc của dòng tế bào ung thư vú BT474.

Khả năng hấp thụ phức hệ thuốc (sản phẩm thu được ở ví dụ 3) được thể hiện trên Hình 5.

Kết quả cho thấy, phức hệ được tập trung bám trên bề mặt tế bào ung thư nhưng không phát hiện thấy đối với tế bào thường. Điều này chỉ ra rằng, phức hệ được vận chuyển một cách đặc hiệu tới bề mặt tế bào ung thư.

Hiệu quả đạt được của giải pháp hữu ích

Bằng việc ứng dụng các phân tử ADN đặc hiệu với kháng thể trên tế bào ung thư, giải pháp đưa ra cách tiếp cận mới đặc hiệu trong điều trị bệnh ung thư biểu mô bao gồm bệnh ung thư vú, ung thư buồng trứng, ung thư phổi và ung thư tiền liệt tuyến. Các phân tử ADN đặc hiệu này giúp vận chuyển thuốc đến tế bào đích một cách đặc hiệu, tăng khả năng tiêu diệt tế bào ung thư, giúp điều trị bệnh ung thư một cách hiệu quả, ít tác động phụ.

Bằng cách sử dụng phân tử ADN làm chất dẫn, đã khắc phục được các hạn chế từ việc sử dụng các hóa chất dẫn thuốc cũng như giảm lượng thuốc cần điều trị cho bệnh nhân ung thư. Các phân tử ADN tương thích sinh học tốt với cơ thể sống nên không bị các phản ứng phản vệ của cơ thể, giúp việc điều trị bệnh ung thư hiệu quả.

Phức hệ vận chuyển thuốc hướng đích có khả năng bao gói thuốc đạt tới 97%, cao hơn nhiều so với các phức hệ đóng gói thuốc thông thường như polylactic, polyethylen glycol đang được sử dụng (khoảng 60%). Ngoài ra cùng với việc bổ trí các đoạn mồi, các trình tự có khả năng kích thích miễn dịch cùng vói việc làm ổn định thuốc bằng chitosan, phức hệ vận chuyển thuốc theo giải pháp hữu ích có khả năng vận chuyển thuốc tới các tế bào, nhận biết các chỉ thị đặc trưng của tế bào ung thư và tăng cường đáp ứng miễn dịch, ngăn ngừa bệnh ung thư tái phát.

Quy trình sản xuất phức hệ dẫn thuốc đơn giản, hiệu quả, bằng cách sử dụng phương pháp tái tổ họp, có khả năng sản xuất và thu nhận lượng lớn phân tử ADN tái tổ hợp có khả năng sản xuất ra phức hệ dẫn thuốc, nhằm giảm chi phí, tăng hiệu quả sản xuất.

10. Nội dung có thể chuyển giao

Liên hệ trực tiếp

11. Thị trường ứng dụng
12. Hình ảnh minh họa
In bài viết
Các phát minh, sáng chế khác
 
Banner
Banner home right